Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1
Characteristics of the secondary structures
Terminator: Distance to gene:69 nt. Distance to run of Ts=2 nt. Size=37 nt. Delta G=-10.90 kcal/mol
Antiterminator: Size=40 nt. Delta G= -4.10 kcal/mol
Anti-antiterminator: Size=43 nt. Delta G= -3.30 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
attcattaaataaaagaaaatcccaatgattgaatcgctctcatttacagtctgttgtttttttaagtaaagatttagattaaaaaataaccaaaatgaa
atatctcaaaacatttaattaagtcattttttgtatttacttacacgggttatacataagcttcatctatgtaaatagagtgttaatctgaatgtttcac
tttgttggaacaattgtcagatcaatttttggcttttagcatgatgaacaagtcctgacccaacccgtgtttagacactactcaggatgtcatagtttat
TTG
ACIAD1024
Gene: ACIAD1024 GI: 50084226 BI number: ACIAD1024 GOG: ------- Description: hypothetical protein; putative signal peptid
ta
ca g a
a c ta
tg at
tg ta
cg cg tt
at ta t g
t t | g c t
t | | t at
ta | g cg
at | t tg
ta | t ta
gc | a ta
ta | a gc
t t | t ta
ta | c | a
ta at | t
t | cg | t
t | ta a g
a | ta at
c | | t gc
tg cg ta
gc gt cg
at at ta
at at at
caatttttggcttttagcatgatgaacaagtcctgacccaacccgtgtttagacactactcaggatgtcatagtttatTTG
..................................................................................................................