                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:15 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -6.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGATGATGTGACAGGTGAAGAACTTGTTCAGCGTCCAGATGATTTAGAAGAAACCATT
CGTAAGCGTCTTGGGTCTTACCACAGTGAAACTGAACAATTGGTTGGTTTCTATCAAG
GTCGTGCAGCGTCTGGTGAAAATGCACCGACATATAACAAATTAGATGGCTTACGTAC
CATTGATGTGGTTCAAAAAGATCTATTTGCTATTTTAGACGAGACTAAATAAtttatttgg
ttttttgctaatataaaagagtcctgattattgcaggactcttttatattttgaggatatcctgtTTG

    ACIAD1106 Gene: ACIAD1106     GI: 50084301     BI number: ACIAD1106     GOG: -------     Description: hypothetical protei             t           t  t           t  t            tg            gc            gt            ta            ta         a           |  t      t  t            ta       t  t            at       a  g   t        ta        gc A  t       ta        ta At        ta        cg Ta       A  a       cg At       A  g       ta At       T  |       gc At       A  |       at Tg       A  |       gc Cg       A  |       at At        Ta        at Gt        Cg        at At        At        at Gt        Gc        ta                         tattttgaggatatcctgtTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:22 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.50 kcal/mol Antiterminator: Size=42 nt.     Delta G= -5.10 kcal/mol Anti-antiterminator:   Size=25 nt.     Delta G= -6.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGATGATGTGACAGGTGAAGAACTTGTTCAGCGTCCAGATGATTTAGAAGAAACCATT CGTAAGCGTCTTGGGTCTTACCACAGTGAAACTGAACAATTGGTTGGTTTCTATCAAG GTCGTGCAGCGTCTGGTGAAAATGCACCGACATATAACAAATTAGATGGCTTACGTAC CATTGATGTGGTTCAAAAAGATCTATTTGCTATTTTAGACGAGACTAAATAAtttatttgg ttttttgctaatataaaagagtcctgattattgcaggactcttttatattttgaggatatcctgtTTG     ACIAD1106 Gene: ACIAD1106     GI: 50084301     BI number: ACIAD1106     GOG: -------     Description: hypothetical protei             t           t  t           t  t            gt            gg            tc            tt            ta           |  a            at            ta   t        tt A  t       ta At        Aa Ta       A  a        a At       T  a      t  t At       A  |      t  t At       A  |      a  g Tg       A  |       gc Cg       T  |       ta At        Cg        cg Gt        Aa        cg At        Gg        ta Gt        At        gc                         tcttttatattttgaggatatcctgtTTG     ..................................................................................................................