Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:49 nt.    Distance to gene:100 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=36 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tctaat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatactcctaaacttctttatttctaatagtttgtcaatgtaaataagaatatcaccatgcctataattatgtcttgatatttgctgcatgaaaatgc
aggtagtgtattgttttgtttttaaatagaccatctaaaacatggacagcgcgtcaattaaaaaactttttttctcaatttttttggagtaaggtgataa
aaaatgatcataggacgatgagaATG

    ACIAD1198


Gene: ACIAD1198     GI: 50084387     BI number: ACIAD1198     GOG: COG4323     Description: conserved hypothetical protei



 at
t  a
c  a
c  t
 gt        aa
 ta       g  a
 at        ta
 cg        at
|  t       cg
|  c       gc
c  t       ta
 at        cg
 cg       g  g
 ta       t  t
 at        ta
 ta        tg
 at        at
 at        tg
 gt        at
            attgttttgtttttaaatagaccatctaaaacatggacagcgcgtcaattaaaaaactttttttctcaatttttttggagtaaggtgataaaaaatgatcataggacgatgagaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG4323 Predicted membrane protein ... can be seen here

    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:49 nt.    Distance to gene:107 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:16 nt. Size=36 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -3.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgata-tctaat. It has a score value of 62.25 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatactcctaaacttctttatttctaatagtttgtcaatgtaaataagaatatcaccatgcctataattatgtcttgatatttgctgcatgaaaatgc
aggtagtgtattgttttgtttttaaatagaccatctaaaacatggacagcgcgtcaattaaaaaactttttttctcaatttttttggagtaaggtgataa
aaaatgatcataggacgatgagaATG

    ACIAD1198


Gene: ACIAD1198     GI: 50084387     BI number: ACIAD1198     GOG: COG4323     Description: conserved hypothetical protei


 tt
t  c
 at
 ta
 ta
t  t
c  |
t  |
 ta
 cg
 at        cc
 at       g  t
 at       t  a
 tg       a  t
|  t       ca        aa
|  c       ca       g  a
c  a       at        ta
c  a       ct        at
t  t      |  a       cg
 cg       |  t       gc
 at       t  g       ta
 ta        at        cg
|  a       tc       g  g
a  a       at       t  t
 gt        at        ta
 ta        gg        tg
 ta        aa        at
 cg        at        tg
 Ta        ta        at
                        attgttttgtttttaaatagaccatctaaaacatggacagcgcgtcaattaaaaaactttttttctcaatttttttggagtaaggtgataaaaaatgatcataggacgatgagaATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[S] COG4323 Predicted membrane protein ... can be seen here

    ..................................................................................................................