                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.20 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -8.30 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-12.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTCACTCTATGCAACAGGCTGCACGTGTTTCTGATCGTACTGCCTATTTCCATTTAG
GTGACTTGATTGAAGTGAATTCGACAGAAAAAGTATTTACTCAGCCTGATCATCAGCT
TACCGAAGCGTATATTACTGGACGTTTTGGTTAAgacttcggttttttagaaagagcccatttgggctctttttt
atgattaaaccaagatcatgatcacatcattttcaaaatagatattgaattctggattaaatgacctcatcttagtttaaatacagcgaaattagagaat
agccaaactATG

    ACIAD1216 Gene: ACIAD1216     GI: 50084405     BI number: ACIAD1216     GOG: -------     Description: putative protease (SohB            tc TA       t  g T  C       cg A  T       at T  G       gt A  G      |  t TA       |  t GC        At CG        At GT        Ta AT        Tg AT       G  a GT       G  a CG        Ta        tt CG        Tg       a  t |  T       Ta        cg AT        Tg        cg TA        Gc        cg TA       C  |       gc Cg       A  |       at |  a       Gc        gc Gc        Gc        at At        Ta        at                         ttttatgattaaaccaagatcatgatcacatcattttcaaaatagatattgaattctggattaaatgacctcatcttagtttaaatacagcgaaattagagaatagccaaactATG     ..................................................................................................................