                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G= -8.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGTTACAATGTTGAAAAACCTTATGAAAAGTTAAAAGCATTAACACGTGGTCAAGC
AATGACGCGCGACATGATGGTTAACTTTGTAAACGGTGATGAACTTAGTCAGGTACCT
GCCGAAGAACGTGCACGCTTAGCAGAAATGACACCAGCCAGCTATACAGGTAACGCTG
CAGATCAAGCAAAACAGATCAATGATTTGATCAATAAAATTTAAtctgaatcagttaaactagagcg
gaatcattttaaatggttccgcttttttatactcatttcatacataacgaagaatctcaATG

    ACIAD1217 Gene: ACIAD1217     GI: 50084406     BI number: ACIAD1217     GOG: COG3647     Description: conserved hypothetical protein; putative membrane protei GA T  T AT AT CG         c TA       a  t AT       a  a GC       a  g A  A       ta C  A       tg         t A  T       gc       t  a A  A      a  g       ta A  A       cg        ta A  A       ta        at C  A      a  a       cg GT        at        tg AT        gc        at AT        ta        at C  A      c  t       gc TA       t  t       gc At        At        cg Gc        At        gc At        Ta        at Cg        Ta        gt                         ttttatactcatttcatacataacgaagaatctcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG3647 Predicted membrane protein ... can be seen here     ..................................................................................................................