                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:109 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTGAAGGGTGTGTTTGCAGCAGGTGACTGTACCACAGTGCCGTACAAGCAGATCATCA
TTGCCACAGGTGAAGGTGCCAAAGCGTCTCTGTCTGCTTTTGATTATATTATTCGTCA
TGGCTGAttaatctctatttataagctcactttttataaggcttatctccctcgatagataagcctttttttttattgcattttttaacatttta
tttacaaatataaagcacttccctctcccatttaagcttaacatttagtcttccatgtttattggatgccaaaatagaaggaataaacaATG

    ACIAD1233 Gene: ACIAD1233     GI: 50084420     BI number: ACIAD1233     GOG: -------     Description: conserved hypothetical protein; putative signal peptid            tc           c  g tt       c  a t  t      c  t t  a       ta c  t       cg a  a       ta c  a       at tg        ta cg        ta gc        cg at        gc at        gc ta        at at        at             tttttttattgcattttttaacattttatttacaaatataaagcacttccctctcccatttaagcttaacatttagtcttccatgtttattggatgccaaaatagaaggaataaacaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -7.70 kcal/mol Antiterminator: Size=26 nt.     Delta G= -3.90 kcal/mol Anti-antiterminator:   Size=35 nt.     Delta G= -5.20 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GTGAAGGGTGTGTTTGCAGCAGGTGACTGTACCACAGTGCCGTACAAGCAGATCATCA TTGCCACAGGTGAAGGTGCCAAAGCGTCTCTGTCTGCTTTTGATTATATTATTCGTCA TGGCTGAttaatctctatttataagctcactttttataaggcttatctccctcgatagataagcctttttttttattgcattttttaacatttta tttacaaatataaagcacttccctctcccatttaagcttaacatttagtcttccatgtttattggatgccaaaatagaaggaataaacaATG     ACIAD1233 Gene: ACIAD1233     GI: 50084420     BI number: ACIAD1233     GOG: -------     Description: conserved hypothetical protein; putative signal peptid TT A  A T  T A  T T  C TG        ct AT       t  a       tc GC       c  t      c  g TA       t  t      c  a T  T      a  t      c  t T  |      a  a       ta TG        tt        cg CG        ta        ta GC        Aa        at T  T       Gg        ta CG        Tc        ta TA        Ct        cg Gt        Gc        gc                         ctttttttttattgcattttttaacattttatttacaaatataaagcacttccctctcccatttaagcttaacatttagtcttccatgtttattggatgccaaaatagaaggaataaacaATG     ..................................................................................................................