                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:204 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-10.60 kcal/mol
Antiterminator: Size=18 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ataatttgtaaaagtcattaagtacttgcggtgtgtgactatgaagacaagtacttaatcgttgggttggagaagccgcatatttatgcggcttctttct
gtttatgatgactatgcggttttacttataatagtttgatcaatcggttataccgaccgtttgtcagattgttggcataagcattgcttagtctataaag
gattcatatgtttaaaatttaggatgcctaaaaaaaatttcatcctgaagcatatgcacacgaaattacgaaatgctcaattttctcatagggcgatgtt
ATG

    ACIAD1243 Gene: ACIAD1243     GI: 50084430     BI number: ACIAD1243     GOG: COG2252     Description: putative transporte   a g  g       tt g  a      a  t ta        ta tg        at gc        cg gc        gc |  g       cg gc        cg ta        gc             ttctttctgtttatgatgactatgcggttttacttataatagtttgatcaatcggttataccgaccgtttgtcagattgttggcataagcattgcttagtctataaaggattcatatgtttaaaatttaggatgcctaaaaaaaatttcatcctgaagcatatgcacacgaaattacgaaatgctcaattttctcatagggcgatgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG2252 Permeases ... can be seen here     ..................................................................................................................