Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:63 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.80 kcal/mol
Antiterminator:    Distance from promoter:29 nt. Size=40 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATA-GATCGT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATATTATTTCAACGGGTCCAGATCGTGCTGAAACAATGATATTGCGTCATCCATT
TTCTGCTTAAgatcttgtattgaaatacgactaaagagaagctcctgatcaggagcttttcttttttagataggtacaataaaaaataatcaa
tatttcataatgagaaagagtattttaacctgATG

    ACIAD1259


Gene: ACIAD1259     GI: 50084445     BI number: ACIAD1259     GOG: -------     Description: hypothetical protein; putative membrane protei


  T
T  G
A  C
 TG
 AT
 GC
 TA        ga
 AT       t  a
|  C       ta
|  C       at
A  A       ta
C  T       gc
 AT        tg
 AT        ta
 AT       c  |       at
 GC       t  |      g  c
T  T      a  |       ta
 CG        gc        cg
 GC        At        cg
|  T      A  a       ta
|  T       Ta        cg
T  A       Ta        gc
G  A       Cg        at
 Cg       G  |       at
 Ta        Ta        gt
 At        Cg        at
 Gc        Ta        gc
 At        Ta        at
                        tttttagataggtacaataaaaaataatcaatatttcataatgagaaagagtattttaacctgATG
    ..................................................................................................................