Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=31 nt.     Delta G= -3.30 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -8.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGAGCAGATACGATTCCTGCTGTATTTACCAAAATCCATTTACACTTTGTCGTGACTG
GCAAACAAATTAAAGAAAAACAAGTGGCGAAAGCTATTGAACTTTCTGCAGAGAAATA
TTGTTCCGCTAGTAAAATGCTGACCGATGGTGGCGTTGTCATTACCCATGATTTTGAA
ATTATAGAAGTAGACGCTTAAcctatgtggtttgaaaaaatgaagctgacgttaatgtcagctttttctttttatagaatgtgcg
aaatataattataatttgaagttataaaaaggaaaagaagcATG

    ACIAD1264


Gene: ACIAD1264     GI: 50084450     BI number: ACIAD1264     GOG: -------     Description: putative acyltransferase; putative acyltransferase for phosphonate utilization (PhnO


 TG
T  A
 TA
 TA
 AT
 GT
 TA
 AT
C  A        t
C  G      a  g
C  |      t  t
A  |       cg
 TA        cg
 TA        At
A  G       At
C  T      |  t
T  A      |  g
G  |      |  a       ta
 TG       |  a      t  a
 TA       |  a       gt
 GC       |  a       cg
 CG       |  a       at
 GC       |  a       gc
 GT       |  t       ta
|  T      |  g       cg
|  A       Ta        gc
 TA        Ta        at
 Gc        Cg        at
 Gc        Gc        gt
                        ttctttttatagaatgtgcgaaatataattataatttgaagttataaaaaggaaaagaagcATG
    ..................................................................................................................