                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:73 nt.    Distance to gene:40 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=46 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:    Distance from promoter:7 nt.    Size=58 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TCGAGA-TTTAAT. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGAGATGCAATATATCAAATGCTTTAATCAACGCACGGTTGAACGCATCATATATTT
AAATAATGTCTTTAATTAAgtgcttgagtaagactgatatttgcaaaggacgattgattcgtcctttttttattggcatgcttaag
ccattttgctagcaatcggataagtgATG

    ACIAD1273 --- ACIAD1274 Gene: ACIAD1273     GI: 50084459     BI number: ACIAD1273     GOG: COG5495     Description: conserved hypothetical protein Gene: ACIAD1274     GI: 50084460     BI number: ACIAD1274     GOG: -------     Description: conserved hypothetical protein; putative SAM-dependent methyltransferas   T G  C T  T AT AT TA A  A        g AT       t  a AT       c  t TA       a  a TA        gt Tg        at At        at Tg        tg A  c       gc T  t      a  a At       g  | Cg        ta Ta        ta A  |       cg         g Cg       g  g      t  a Gt        ta       t  t C  a       gc        at A  a      A  |       gc A  |      A  |       cg G  |       Tg        at Tg        Ta        gc Ta        At        gc Gc        At        at Gt        Tg        at Cg        Ta        at                         ttttattggcatgcttaagccattttgctagcaatcggataagtgATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG5495 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................