                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:54 nt.    Distance to gene:140 nt.     Distance to run of Ts=3 nt.   Size=24 nt.     Delta G= -6.00 kcal/mol
Antiterminator:    Distance from promoter:26 nt. Size=38 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-tattct. It has a score value of 67.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatttagactcggttatgttgatattctgattttttataatctgcttataagaattttaatatctagacttaatgaaatctagcttttaaaagacatt
ttaaaggtgtgtgtttttctgcttaagtatttgatttttattttattttttataaatgttggcctaaaaattgctatttgatttatggaagaatccaagt
tttcgatatctattcagatgtgttgaaacttgggtaagcgaatatggatcctgggggaagtATG

    ACIAD1276 --- ACIAD1277 --- ACIAD1279 --- ACIAD1280 Gene: ACIAD1276     GI: 50084462     BI number: ACIAD1276     GOG: COG0531     Description: putative amino acid transporter Gene: ACIAD1277     GI: 50084463     BI number: ACIAD1277     GOG: -------     Description: conserved hypothetical protein Gene: ACIAD1279     GI: 50084464     BI number: ACIAD1279     GOG: -------     Description: putative UDP-N-acetylmuramyl tripeptide synthase Gene: ACIAD1280     GI: 50084465     BI number: ACIAD1280     GOG: COG4242     Description: conserved hypothetical protein; putative exopeptidas   t c  g t  c at at ta at ta ta tg        at ta       a  g ta        ta t  t       ta at       c  a gt        at t  t       gc c  |       at        ac ta        ta       g  a ta        cg        at at       t  c       at ta       a  t       at at       t  t       at gc        at        ta |  t       at        ta |  a       ta        ta tg        ta        tg ta        ta        cg gc        ta        gt                         gtgtgtttttctgcttaagtatttgatttttattttattttttataaatgttggcctaaaaattgctatttgatttatggaagaatccaagttttcgatatctattcagatgtgttgaaacttgggtaagcgaatatggatcctgggggaagtATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0531 Amino acid transporters ... can be seen here [QP] COG4242 Cyanophycinase and related exopeptidases ... can be seen here     ..................................................................................................................