Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=63 nt.     Delta G= -4.20 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -4.74 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGCGTAGGAACTGCTAGCGATGCTGCAATCGCAATGGAACTCGGCTGCGATGGCGT
GCTGATGAATACAGCAATTGCAGCAGCTCAACATCCAGTTTTGATGGCATCTGCCATG
AAAAAAGCGATTGAAGCAGGCCGAGAAGCCTTTTTAGCGGGTCGTATGCCACGCAAAC
GAATGGCGAATGCCAGCTCTCCAGAAACAGGCTATTTCTTTAAATAAcgcatactattattatat
tgaaaagtttcaaaggattcttcggaatcctttttcataaaaacaatgagagcaagcgcaaATG

    ACIAD1306


Gene: ACIAD1306     GI: 50084489     BI number: ACIAD1306     GOG: -------     Description: conserved hypothetical protein; putative signal peptid


            t
          a  a
          c  c
          g  t
          c  a
           At
           At
           Ta
           At
           At
          |  a
           At
           Ta
          T  t
          T  t
 CC        Cg
G  A       Ta
T  G       Ta
A  C       Ta
 AT       A  |
 GC        Ta
C  T       Cg
 GC        Gt
 GC        Gt
 TA        At
A  G      C  c
A  A      A  a       tc
G  A      A  a      t  g
C  A      A  a       cg
A  C      G  |       ta
A  A      A  |       ta
A  G       Cg        at
 CG        Cg        gc
 GC        Ta        gc
                        tttttcataaaaacaatgagagcaagcgcaaATG


    ..................................................................................................................