                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:74 nt.     Distance to run of Ts=0 nt.   Size=13 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=54 nt.     Delta G=-11.00 kcal/mol
Anti-antiterminator:   Size=36 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGAGGCTATGAATCAACTTGATGATCGTTCGAGAAATATTTTACAGCGTCGCTGGCTA
GATGATGACAAATCAACATTACATGAGCTCGCTGCGGAATATAACGTTTCTGCCGAAC
GTATTCGACAGCTTGAAAAAAATGCCATGGAAAAAATCAAAGTTGCGATGTCCGCAGG
CTAAattatttcgtttaagtcatatagaaacttaagggcatcatgcccttttgttttgtttaactatttttagccaacctgatttgtgctaatgttc
tagcgtcttttttaacgatcattgcgcttATG

    ACIAD1310 --- thiS --- thiG Gene: ACIAD1310     GI: 50084492     BI number: ACIAD1310     GOG: COG2363     Description: conserved hypothetical protein; putative membrane protein Gene: thiS     GI: 50084491     BI number: ACIAD1309     GOG: -------     Description: C-terminally thiocarboxylated form is intermediate sulfur donor in thiazole formation; part of ThiF/ThiS complex; complexes with ThiG also Gene: thiG     GI: 50084490     BI number: ACIAD1308     GOG: COG2022     Description: thiamine biosynthesis protein, thiazole moiet             g           a  t           a  c            ta            tt            ta            gt           c  a            tg GT        ta A  T      t  a A  G       aa A  C       tc CG        tt TA       |  t AT       |  a A  G      a  a A  |       Ag A  |       Ag A  |      |  g AT       T  c GC       C  a GC        Gt         c TG        Gc       t  a |  C       Aa       a  t A  A       C        cg CG        G        gc CG        C        gc GC        C        gc                         ttttgttttgtttaactatttttagccaacctgatttgtgctaatgttctagcgtcttttttaacgatcattgcgcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2363 Uncharacterized small membrane protein ... can be seen here [H] COG2022 Uncharacterized enzyme of thiazole biosynthesis ... can be seen here     ..................................................................................................................