Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:94 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.80 kcal/mol
Antiterminator:    Distance from promoter:82 nt. Size=28 nt.     Delta G= -5.00 kcal/mol
Anti-antiterminator:    Distance from promoter:38 nt.    Size=58 nt.     Delta G= -9.20 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-AACGAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAACCTTGAGAAGAAGCGCAACGATACTGCCAAAAATGCAGCGGATAGTTATAT
TGATGTGAATATCGATGCTGCTTCTGTGGATTTGACTGGAATTCGAGAGCTATAAgatt
tgttgatgaaaaagcgggtttttcccgcttttttattttatgattggacaaaacaatatcactaggattgtTTG

    ACIAD1324


Gene: ACIAD1324     GI: 50084506     BI number: ACIAD1324     GOG: -------     Description: hypothetical protein; putative membrane protei


  C
A  T
G  G
 TG
 TA
 TA
 AT
 GT
 GC
 TG
G  A
T  |
C  |
 TG
 TA
 CG
 GC
|  T
|  A
|  T                  t
|  A       ga       t  t
 TA       t  a      t  t
 Cg       a  a       gc
|  a      g  a       gc
|  t       ta        gc
|  t       tg        cg
G  t       gc        gc
 Tg        tg        at
 At        tg        at
 Gt        tg        at
 Cg        at        at
 Ta        gt        at
 At        At        gt
 Tg        At        ta
                        ttttatgattggacaaaacaatatcactaggattgtTTG


    ..................................................................................................................


                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:101 nt.    Distance to gene:39 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -8.30 kcal/mol
Antiterminator:    Distance from promoter:60 nt. Size=28 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-AACGAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAACCTTGAGAAGAAGCGCAACGATACTGCCAAAAATGCAGCGGATAGTTATAT
TGATGTGAATATCGATGCTGCTTCTGTGGATTTGACTGGAATTCGAGAGCTATAAgatt
tgttgatgaaaaagcgggtttttcccgcttttttattttatgattggacaaaacaatatcactaggattgtTTG

    ACIAD1324


Gene: ACIAD1324     GI: 50084506     BI number: ACIAD1324     GOG: -------     Description: hypothetical protein; putative membrane protei



 GA
C  G
T  A
T  G
 AC
 AT
 GA         t
 GT       t  t
 TA       t  t
 CA        gc
 Ag        gc
 Ga        gc
 Tt        cg
 Tt        gc
            ttttttattttatgattggacaaaacaatatcactaggattgtTTG


    ..................................................................................................................