                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -4.72 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGCAACCAATGTGATTGGAAACAGTATTGCGACAGCAGTAGTTGCTAAAACTGAAGCA
CATGAGCATGATGAAGTGATTGAAGATGCGCATATCGTAGATGACATCGTGCCTGTGA
GTACGACAGGTCATTCATAAattgaaattatcgttgtgtgattaagtcacgataatagagagcctgcataagcaggcttttttgt
atttgatatcagccttttttgggcaggatagcttctattgaagaaagagtttgttatattggttgggtttatattgagtaatagggcgatacaggcttgA
TG

    ACIAD1340 Gene: ACIAD1340     GI: 50084520     BI number: ACIAD1340     GOG: -------     Description: hypothetical protein; putative signal peptid             a           t  a            tg            at            gc            ta            gc           |  g            ta            gt            ta   t        ta a  t       gt a  a      |  a at        cg gc        ta tg       |  g       ta t  t      a  a      a  a a  t      t  g       cg A  g      t  c       gc At       a  c       ta Tg       a  t       cg At       a  g       cg Cg        gc        gc Ta        ta        at                         tttttgtatttgatatcagccttttttgggcaggatagcttctattgaagaaagagtttgttatattggttgggtttatattgagtaatagggcgatacaggcttgATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=20 nt.     Delta G=-13.10 kcal/mol Antiterminator: Size=46 nt.     Delta G= -4.72 kcal/mol Anti-antiterminator:   Size=27 nt.     Delta G= -3.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TGCAACCAATGTGATTGGAAACAGTATTGCGACAGCAGTAGTTGCTAAAACTGAAGCA CATGAGCATGATGAAGTGATTGAAGATGCGCATATCGTAGATGACATCGTGCCTGTGA GTACGACAGGTCATTCATAAattgaaattatcgttgtgtgattaagtcacgataatagagagcctgcataagcaggcttttttgt atttgatatcagccttttttgggcaggatagcttctattgaagaaagagtttgttatattggttgggtttatattgagtaatagggcgatacaggcttgA TG     ACIAD1340 Gene: ACIAD1340     GI: 50084520     BI number: ACIAD1340     GOG: -------     Description: hypothetical protein; putative signal peptid             t           t  a            aa            gg            tt            gc            ta           |  c            gg            ta            tt   t        ga a  t       ca a  a      |  t at        ta gc        ag        ta tg       |  a      a  a t  t      t  g       cg a  t      t  a       gc A  g      a  g       ta At       a  c       cg Tg       a  c       cg At       g  t       gc Cg        tg        at Ta        tc        gt                         ttttgtatttgatatcagccttttttgggcaggatagcttctattgaagaaagagtttgttatattggttgggtttatattgagtaatagggcgatacaggcttgATG     ..................................................................................................................