                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:66 nt.    Distance to gene:92 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.40 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=40 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:    Distance from promoter:16 nt.    Size=43 nt.     Delta G= -3.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TATCCA. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAACATTGGAAAATATTACTTATCCATATGAAGAAATTACACACAATGTGGGTTA
TAAACGCTTTTTGCAGTAAaaatcgattgttctcaccaaccgacattcttgcgaactgtcggtttttttatatctttttaacattt
ctttgcgctaggcatagacagaaaatactacactcactttaatcaaaacatctctaaaacaatatcatttacttaggctaatttATG

    ACIAD1356 --- ACIAD1355 Gene: ACIAD1356     GI: 50084535     BI number: ACIAD1356     GOG: COG0569     Description: putative potassium uptake protein Gene: ACIAD1355     GI: 50084534     BI number: ACIAD1355     GOG: COG0168     Description: putative potassium uptake protein (TrkH   T T  T T  T CG GC         t C  A      c  c A  |      t  a A  |      t  c A  |       gc TG        ta AT        ta TA       a  c       tg TA        gc       t  c |  a       cg        cg |  a       ta        ta G  a      a  c       ta Gt       a  a      |  c Gc       a  |       at Tg        At        cg G  |       At        at Ta       T  c       gc At        Gt        cg At        At        cg Cg        Cg        at At        Gc        at                         tttttatatctttttaacatttctttgcgctaggcatagacagaaaatactacactcactttaatcaaaacatctctaaaacaatatcatttacttaggctaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0569 K+ transport systems, NAD-binding component ... can be seen here [P] COG0168 Trk-type K+ transport systems, membrane components ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:66 nt.    Distance to gene:101 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-11.40 kcal/mol Antiterminator:    Distance from promoter:31 nt. Size=40 nt.     Delta G= -3.40 kcal/mol Anti-antiterminator:   Size=68 nt.     Delta G= -9.36 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGAAA-TATCCA. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGAAACATTGGAAAATATTACTTATCCATATGAAGAAATTACACACAATGTGGGTTA TAAACGCTTTTTGCAGTAAaaatcgattgttctcaccaaccgacattcttgcgaactgtcggtttttttatatctttttaacattt ctttgcgctaggcatagacagaaaatactacactcactttaatcaaaacatctctaaaacaatatcatttacttaggctaatttATG     ACIAD1356 --- ACIAD1355 Gene: ACIAD1356     GI: 50084535     BI number: ACIAD1356     GOG: COG0569     Description: putative potassium uptake protein Gene: ACIAD1355     GI: 50084534     BI number: ACIAD1355     GOG: COG0168     Description: putative potassium uptake protein (TrkH TT A  A A  C A  A G  C A  A A  C G  A TA AT TG AT CG CG TG         t AT       a  c |  T      a  g |  A      a  a T  T       At T  A       At C  A       Tg A  A      G  t       tg T  C       At       t  c T  G       Cc        cg A  C       Gt        ta T  T      T  c       ta AT       T  a      |  c AT       T  |       at AT        Tc        cg AT        Tc        at G  G      C  a       gc GC        Ga        cg TA        Cc        cg TG        Ac        at AT        Ag        at                         tttttatatctttttaacatttctttgcgctaggcatagacagaaaatactacactcactttaatcaaaacatctctaaaacaatatcatttacttaggctaatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0569 K+ transport systems, NAD-binding component ... can be seen here [P] COG0168 Trk-type K+ transport systems, membrane components ... can be seen here     ..................................................................................................................