                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-11.80 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCACATCGCGGTGAAGAAATCTCTGAAAATATGCTAGATCACAAGAACTCCGTGGTTT
GGGATGAAGCAGAAAATCGGCTCCATGCACAGAAAGCATTGATGGAATTTTTATTAAA
TGAAAATGCCAAAAGAGCCTAAaatctttttaaacattttaaaaagcccctagccaagcactatgggcttttttatttcataac
gtctttataataatccaaaatcaatatattcatacgaagtttactgatacattaagtctaaatagatcattttataaaatgagaaaatatgaaaataaaa
ATG

    ACIAD1365 Gene: ACIAD1365     GI: 50084544     BI number: ACIAD1365     GOG: -------     Description: conserved hypothetical protein; putative esterase/lipas   a c  t at         a at       a  g at       c  c ta       c  a ta        gc ta        at ta        ta ta       c  t cg        cg t  c       cg a  c       cg a  c       gc A  c       at At        at Ta        at Cg        at             ttatttcataacgtctttataataatccaaaatcaatatattcatacgaagtttactgatacattaagtctaaatagatcattttataaaatgagaaaatatgaaaataaaaATG     ..................................................................................................................