                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-12.60 kcal/mol
Antiterminator:    Distance from promoter:76 nt. Size=41 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:    Distance from promoter:18 nt.    Size=79 nt.     Delta G=-15.72 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TGGTTT-TACAGT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TGGTTTTGATTTAGGTAATCTACGTTACAGTGTTGGTGTAGGTTTTACTTGGATTACG
ATGATTGGACCTCTTTCTTTAAGTTATGCATATCCGCTTAACAAGAAAGATGGCGATG
AAACTCAATCTATTCAATTTGAAATTGGCCGTACTTTCTAAgtacggtctatttttattgtataaagttt
cctgatttaaggaatgaatATG

    ACIAD1379 --- lpxD --- fabZ --- lpxA Gene: ACIAD1379     GI: 50084557     BI number: ACIAD1379     GOG: -------     Description: putative outer membrane protein (OmpH) Gene: lpxD     GI: 50084558     BI number: ACIAD1380     GOG: COG1044     Description: UDP-3-O-[3-hydroxylauroyl] glucosamine N-acyltransferase Gene: fabZ     GI: 50084559     BI number: ACIAD1381     GOG: COG0764     Description: (3R)-hydroxymyristoyl-[acyl carrier protein] dehydratase Gene: lpxA     GI: 50084560     BI number: ACIAD1382     GOG: COG1043     Description: UDP-acetylglucosamine acyltransferas AT T  C A  C CG GC T  T AT TA TA GC A  | A  | T  | TA TA CG TA TA TA CG TA        TT |  T      A  C CG       T  A CG       C  A A  |      T  T G  |       AT GC        AT TG        CG         C TA        TA       T  T AT       C  A       TA |  G      A  |       TA G  A      A  |       Cg T  A      A  |       At A  A      G  |       Ta G  C       TA        Gc C  T       AT        Cg A  C       GT        Cg TA       |  G       Gt TA        CG        Gc AT        GC       T  t GC        GC        Ta GT        TG        At TA        AT        At                         tttattgtataaagtttcctgatttaaggaatgaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1044 UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase ... can be seen here [I] COG0764 3-hydroxymyristoyl/3-hydroxydecanoyl-(acyl carrier protein) dehydratases ... can be seen here [M] COG1043 Acyl-[acyl carrier protein]--UDP-N-acetylglucosamine O-acyltransferase ... can be seen here     ..................................................................................................................