                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:60 nt.    Distance to gene:76 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-11.50 kcal/mol
Antiterminator:    Distance from promoter:40 nt. Size=30 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:   Size=70 nt.     Delta G=-10.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAGT-TATCTT. It has a score value of 66.27 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAGTCTGCCCAAATTGTCGCTTATCTTAAAAAACAATATGGTGAGGTTTAGcagccatc
tctatatttggaagcatattgtcatcaggaggcattcatattcaaagtgaatgctttttttatatattaaaaaatttaatctttcaaaagcaatatgtta
aattaagatagcaatatatttttcataggttaattccATG

    ACIAD1393 --- ACIAD1394 --- mfd Gene: ACIAD1393     GI: 50084571     BI number: ACIAD1393     GOG: -------     Description: conserved hypothetical protein; putative iron-dependent peroxidase Gene: ACIAD1394     GI: 50084572     BI number: ACIAD1394     GOG: -------     Description: hypothetical protein Gene: mfd     GI: 50084573     BI number: ACIAD1395     GOG: COG1197     Description: transcription-repair coupling protei AG T  c T  a Tg Gc Gc |  a At Gc T  t Gc Gt Ta At Ta At A  | C  | A  | A  | A  | A  | A  | A  | T  | T  | C  | T  | A  | T  | T  | C  | G  | C  |       ca         c T  |      t  t      t  a G  |       gc       t  a T  |       ta       a  a T  |       tg        tg A  |      a  g       at At       t  a       cg At       a  g       ta Cg        cg        ta Cg        gc        at |  a      a  a       cg |  a       at        gc Cg        gt        gt Gc        gc        at Ta        ta        gt                         ttttatatattaaaaaatttaatctttcaaaagcaatatgttaaattaagatagcaatatatttttcataggttaattccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [LK] COG1197 Transcription-repair coupling factor (superfamily II helicase) ... can be seen here     ..................................................................................................................