Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-15.40 kcal/mol
Antiterminator: Size=78 nt.     Delta G=-25.96 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAAGTTTTCAGCTTTGGCTGTTCAAAGCTATGGACAGAGTAATCCGAAATTTTTACTA
CAGGGACGTGATGCAAACACAGGACAATTTACAGGGTCAATCAACAGTATCAGTTATG
GATCGAGCACACCAAAAGCATTGAAATCTCAATAAatccaatccactgagttatgttttaacctgtgcttgatc
cattccggcgcaggttttttaattttagccgtacatataaaaactacgctatagctggtatgcatcttgcttcatctcttttatatatcggtattaagtg
agatcttcacATG

    ACIAD1455


Gene: ACIAD1455     GI: 50084630     BI number: ACIAD1455     GOG: -------     Description: putative transcriptional regulator protein (AraC family


  c
c  a
t  a
a  t
A  c
A  c
T  a
A  c
 At
 Cg
 Ta
 Cg
T  t
A  t
A  |
A  |
G  |
T  |
 Ta
 At
 Cg
 Gt
 At
 At
 At
|  a
A  a
C  c        c
C  c      c  a
 At       t  t
 Cg        at
 At        gc
 Cg       t  c
 Gc        tg
 At        cg
 Gt        gc
 Cg        tg
 Ta        gc
 At        ta
 Gc        cg
 Gc        cg
 Ta        at
            tttttaattttagccgtacatataaaaactacgctatagctggtatgcatcttgcttcatctcttttatatatcggtattaagtgagatcttcacATG
    ..................................................................................................................