                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:199 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.10 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -7.40 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -4.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttattttaattaacttactagttttattaagataagtcaggttttttattggaaaaattttaatagaaaggtgtgatttgtttagcaaattatgtctttt
tgtgataaatatatgtaaaaattttaccgctgttaaaccctaaaaaaatacttactatgcatcgatcagaatctacatctcaaatgagtgataaggggag
caagggaacctgcttgaaaatgttactgctatgcagttcaatttcactggtgacgacttctgtattcgccgaaacatcggataaacttagtttcaataat
TTG

    ACIAD1487 --- ACIAD1488 --- ACIAD1489 Gene: ACIAD1487     GI: 50084658     BI number: ACIAD1487     GOG: -------     Description: putative outer membrane efflux protein, type I secretion protein Gene: ACIAD1488     GI: 50084659     BI number: ACIAD1488     GOG: COG2274,COG4618     Description: putative protein secretion efflux system (ABC superfamily, atp_bind and membrane) Gene: ACIAD1489     GI: 50084660     BI number: ACIAD1489     GOG: COG0845     Description: putative protein secretion efflux system, membrane fusion protein (hemolysin-type secretion transmembrane protein) (superfamily ABC, membrane             a           a  a            at            at            gt            gt            ta aa        ta t  t       at         t aT        ta       t  a aT        tg       t  g cG        ta        gc ta        ta        ta tg        ta        ta t  t       tg        ta g  c      |  g       at a  |      g  t       gt ta       g  g       ta tg        at       g  t cg        cg       t  g at        ta        gt at        gt        gc at        at        at                         ttttgtgataaatatatgtaaaaattttaccgctgttaaaccctaaaaaaatacttactatgcatcgatcagaatctacatctcaaatgagtgataaggggagcaagggaacctgcttgaaaatgttactgctatgcagttcaatttcactggtgacgacttctgtattcgccgaaacatcggataaacttagtttcaataatTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [V] COG2274 ABC-type bacteriocin/lantibiotic exporters, contain an N-terminal double-glycine peptidase domain ... can be seen here [R] COG4618 ABC-type protease/lipase transport system, ATPase and permease components ... can be seen here [M] COG0845 Membrane-fusion protein ... can be seen here     ..................................................................................................................