Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:93 nt.    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.80 kcal/mol
Antiterminator:    Distance from promoter:45 nt. Size=61 nt.     Delta G= -5.20 kcal/mol
Anti-antiterminator:    Distance from promoter:18 nt.    Size=45 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAC-AAAAAT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAACTGAATGCTGACCTATCACAAAAATGGCCAAATATCACACAAATTGGTGACCA
ACCTGCTGATCGAGAAGAATGGAATGGTAAACCAGATAAACTTCAGTATTTAGAGAAG
TAAtttaaaagatcagcattagctgatctttttttatactttaaatcaacatttgattgcaaaattttcaaaatttgttcttcattttgcactaaaat
aacgagcttagaataagttgttgattttattATG

    ACIAD1496


Gene: ACIAD1496     GI: 50084666     BI number: ACIAD1496     GOG: -------     Description: hypothetical protei


           TT
          A  T
          T  A
          G  G
          A  A
           CG
           TA
           TA
 CG        CG
T  A       AT
A  G      A  A
G  A      A  |
 TA        TA
 CG        At
|  A       Gt
G  A       At
T  T      C  a
 CG       C  a
 CG       A  a
|  A      A  a
A  A      A  g       tt
 AT        Ta       a  a
 CG        Gt        cg
 CG        Gc        gc
 AT        Ta        at
|  A      A  g       cg
G  A      A  |       ta
 TA       G  |       at
 GC        Gc        gc
 GC        Ta        at
 TA        At        at
 TG        At        at
                        ttttatactttaaatcaacatttgattgcaaaattttcaaaatttgttcttcattttgcactaaaataacgagcttagaataagttgttgattttattATG


    ..................................................................................................................