Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G=-15.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.20 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGGTCGGCCCGATTCCTGCACCTTACCAAAAAGTCACGGTATTTGCTGCTGGCATT
GGTAAACACTCTGAACATGCAAAAGCAGCAAAAGAACTGATTCAATTTGTAAAATCGC
CTCAAGCGACACAAACGATTGAAGAACAGGGTCTTGAGCAGGTTAAACAATAAaagctcta
aaaggcagcattttgagaggatgttgcctttattctttcggcggtttacgcagcataatagaacaaaatgcacagcgataaacccgtgtagaataataaa
caaaggacaatgtagtatttgccGTG

    ACIAD1539


Gene: ACIAD1539     GI: 50084704     BI number: ACIAD1539     GOG: -------     Description: putative transcriptional regulator (LysR family


  G
A  A
A  A
 GC
 TA
 TG
A  G
G  |
 CG
 AT
A  |
A  |
C  |
A  |
C  |        C
A  |      A  A
G  |      A  A
C  |       AT
 GC        TA
 AT        TA         a
 AT       G  a      g  g
 CG       G  a      t  a
 TA       A  |       tg
 CG        Cg        tg
C  C       Gc        ta
G  A       At        at
 CG        Gc        cg
 TG       |  t       gt
 AT       |  a       at
 AT       |  a       cg
A  A       Ta        gc
A  A       Ta        gc
 TA        Cg        at
 GC        Tg        at
 TA        Gc        at
                        attctttcggcggtttacgcagcataatagaacaaaatgcacagcgataaacccgtgtagaataataaacaaaggacaatgtagtatttgccGTG


    ..................................................................................................................