                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=35 nt.     Delta G= -3.40 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -5.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACTGCTTTTGAAAATCATCAAAACGTCGGGTTTTCATAAAAGCATTACGAATAATCA
GCAAGGTCCAGCGGTCGCCAAAAATTGACAAAGTCCGTGCAATAGGACAATTCATTTC
ACCGAGTTCATGCCATTTCATcgcaataccatctatatgtctttacaggaagcgggctgtcattttaggacaacttgaaggatta
agatatccgctttattgacaacttatcaaggcacctatattttcttattgagttcctttttggaacttaatattttgagatctattcttgaggtgaattA
TG

    ACIAD1547 Gene: ACIAD1547     GI: 50084710     BI number: ACIAD1547     GOG: -------     Description: conserved hypothetical protei   g c  c c  t t  t at ta at gt a  g a  a t  c        a t  a      t  t a  a      c  a gc       c  t gt       a  t at       c  t |  a       gt         t at        gc       t  t gc        at       t  t ta        at        cg ta       c  a       cg cg       t  t       ta a  g       at        ta a  c       tg        gc c  a       ta        at a  |       cg        gt gc        at        ta gc        at        ta                         tattttgagatctattcttgaggtgaattATG     ..................................................................................................................