Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G= -4.04 kcal/mol
Anti-antiterminator:   Size=61 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACGCGTAAGGCAGCCAATCCTAAACTGGCTCTGAACCTGAATGCAGATGAGACGGTTC
CTTATGGTACGGTTGCCAAGTTACTGGCCAGCATAGAACGGGTAGGCGTTGATAAACT
ATCAGTCATTACGTCGCCTAAGTCTTAAgttctatcaaaataaacaagacgaaagaaaatcaagatccaaatttgagat
cttgatttttatataattgtttaatctaaatttatattaaacttgaatttcacgattaggttgtatggtctattttagagcttcaatttgatggtgagat
ggcgaATG

    ACIAD1591


Gene: ACIAD1591     GI: 50084753     BI number: ACIAD1591     GOG: -------     Description: putative transcriptional regulato


  T
C  A
A  T
A  C
A  A
 TG
 AT
 GC
 TA
|  T
|  T
 TA
 GC
 CG
 GT        aa
 GC       a  c
A  |      t  a
 TG       a  a
 GC       a  g
 GC       a  a
 GT       a  c
|  A       cg
|  A       ta
|  G      a  a       at
|  T       ta       a  t
|  C       cg        at
|  T       ta        cg
|  T       ta       |  a
|  A      |  a       cg
|  A      g  a       ta
 Cg       A  t       at
 At       A  c       gc
 At        Ta        at
 Gc        Ta        at
 At        Cg        cg
 Ta        Ta        ta
 At        Gt        at
                        ttttatataattgtttaatctaaatttatattaaacttgaatttcacgattaggttgtatggtctattttagagcttcaatttgatggtgagatggcgaATG


    ..................................................................................................................