                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:59 nt.    Distance to gene:119 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -8.10 kcal/mol
Antiterminator:    Distance from promoter:24 nt. Size=45 nt.     Delta G= -6.90 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-10.72 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAA-TAGAAG. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAAGATCTTGGACTAGCGATAGAAGCGGCAGGACAAGTCAAACAGCCTGTACTTT
TGGCTGGATTGGTACAACAACAATATCAACAGTTATGTATGCAAGGAAATGCACAACT
GGATTTTTCAAGTATTATTCAGCAATATTTACCGCAAAATTCGCAATAAaatcaggcgaagaaa
agcaattaaacagtagaaatttcgattcaaaaataacaatacatctaggatggagtatctgatATG

    ACIAD1606 Gene: ACIAD1606     GI: 50084767     BI number: ACIAD1606     GOG: COG0365     Description: putative acetyl-coA synthetase/AMP-(fatty) acid ligas   C T  A        A G  A      C  A A  A      A  C A  C      A  A C  A      C  A A  G       AT GC        TA GC        GT AT        GC CG        TA GT       T  A       AG G  A      A  |      A  G C  |      G  |      C  A GC        GC       G  A AT        TA        TA AT        CG        AT GT        GT        TG AT        GT        GC TG        TA        TA A  |      T  T      A  C G  |      T  |       TA CG       T  |       TA GC        CG        GC AT        AT        AT TG        TA        CG                         GATTTTTCAAGTATTATTCAGCAATATTTACCGCAAAATTCGCAATAAaatcaggcgaagaaaagcaattaaacagtagaaatttcgattcaaaaataacaatacatctaggatggagtatctgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG0365 Acyl-coenzyme A synthetases/AMP-(fatty) acid ligases ... can be seen here     ..................................................................................................................