                                                                        Gene putatively regulated by attenuation in Acinetobacter_sp_ADP1

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:136 nt.    Distance to gene:37 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -9.10 kcal/mol
Antiterminator:    Distance from promoter:113 nt. Size=38 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaaa-taaaag. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaaaaagacaggttttaatttgatctaaaagaaggtatcgtttaatttatagtaattattgatgcggcaggattgcttgatcaatgtgtaaaaaataa
cgagatgaataaaacagatgagtcttatggaaaagactttaactatgcagagacagggtagataaaaattggcttgaaatttgctttataaaagcaaggc
catattttttgacatcttgtgtagtcgtataagggattaaattaccATG

    ACIAD1622 Gene: ACIAD1622     GI: 50084781     BI number: ACIAD1622     GOG: -------     Description: putative transcriptional regulator (AraC family) (nitrilase regulator   a         t a  a      a  a t  a       ta a  a       ta gt        ta at        cg tg        gc g  g       ta gc        ta gt       t  | at       a  | cg       a  | |  a      a  | a  a      g  | g  a      t  | at        tg gt        cg at        gc cg        gc gc        ta             tattttttgacatcttgtgtagtcgtataagggattaaattaccATG     ..................................................................................................................