                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:85 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-10.70 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -4.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGACAATCGATTATGGTGTACCATGACGGAGGTGTGCTTAAAGCACTCAACATAAGGT
TACCGTTCATCCCGTTGTTTCAGAGAACTGTGCTAAAGTGGATTGCCGAAGTCTATGG
TTCTGTGCTGTGAcacctgttgctaagtgaaaaggtttgaaagcgatagagtaaaagggattaagttgaggcggtggagttttcttcaagt
ttcatttttgaatgtagtttgtggtggttttagttgaagcgggattggcttctccttctagacttagatggtactctctgggatcatttagatGTG

    APE0023 Gene: APE0023     GI: 14600393     BI number: APE0023     GOG: COG4996     Description: hypothetical protei            ag           a  g            at            at            gt            tg           g  a           a  a           a  |            ta            cg            gc            tg            ta            gt            ta            cg           |  a            cg            at           |  a           |  a cc       |  a a  t      |  a cg       |  g At       |  g Gt       |  g       tt Tg       |  a      t  t Gc       |  t       gc |  t      |  t       at |  a      |  a       gt Ta       |  a       gc Cg        cg        ta Gt        At       g  a Tg        Gt       g  | |  a       Tg        cg |  a      G  a       gt G  a       Tg        gt Ta        Cg        at Cg        Gc        gc Tg        Tg        ta                         tttttgaatgtagtttgtggtggttttagttgaagcgggattggcttctccttctagacttagatggtactctctgggatcatttagatGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG4996 Predicted phosphatase ... can be seen here     ..................................................................................................................