                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.20 kcal/mol
Antiterminator: Size=19 nt.     Delta G= -4.30 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-20.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agctggttctaatctctgcaatgagagcaagccactcagctgcttccacatctccctcctctagagccttctcagcggccctaacaaggggccatacatt
ttttgagaagggctcgagactttcaagctcttcttttatactcgcgagcctactctttaggagtccgctccccaaaggcatgagcacatccccgatactt
gttaaggagtggtggatagcgggccccgggagtgcgaatgtgttcttagaggtttaccgatataaaccttgtccgatctccatcactagcgggacctgtc
ATG

    APE0079 Gene: APE0079     GI: 14600432     BI number: APE0079     GOG: COG1586     Description: hypothetical protei   c a  a a  a tg cg cg cg gc gc |  a |  t |  a |  c |  a                  c |  t                a  t |  t                 gt |  t                 at c  t        g        gc gt       a  g      c  a at       a  g       ta cg        gc        cg ta        at        gc cg        gc        gt ta        tg        gc ta        ta        at cg        tg        at cg        ta        gc                         ttttatactcgcgagcctactctttaggagtccgctccccaaaggcatgagcacatccccgatacttgttaaggagtggtggatagcgggccccgggagtgcgaatgtgttcttagaggtttaccgatataaaccttgtccgatctccatcactagcgggacctgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG1586 S-adenosylmethionine decarboxylase ... can be seen here     ..................................................................................................................