                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:53 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G= -9.90 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G=-14.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCCTAAAGGCGAGCTGCCGCCTTTAACGCCGAGGGCTCCAGTAGAAGCTCTTGCTG
GCTGGAACTCTTACGGCGATCTTGAGGATAAGGTGAAGGCGTATATGAGCTTGGGGGA
AAAGTTTGTTAACAATATGTGGCGGGTCCACAGGCACGGCGGCCCCGTTGATAGAATG
GATAATGTTATAAGGGAGTGCCTCAAATCGAGAGGGTTTAGGGTTTAAactcgactcttagctc
tagtcttttacggtaataccatttattatgactctggggcccgcgggttgttagccatagaaGTG

    APE0082 --- APE0080 Gene: APE0082     GI: 14600434     BI number: APE0082     GOG: NOG11268     Description: hypothetical protein Gene: APE0080     GI: 14600433     BI number: APE0080     GOG: COG0433     Description: hypothetical protei GG T  A A  T A  A G  A AT TG AT GT TA T  T                  a G  A                A  c C  A                A  t CG                 T  c CG         G        Tg CG       A  A       Ta G  A      G  G       Gc G  |       CG        Gt C  |       TG        Gc G  |       AT        At G  |       AT       T  t CG        AT        Ta AT       C  A       Tg CG       T  G       Gc GC        CG        Gt GC        CG        Gc AT        GT        At                         agtcttttacggtaataccatttattatgactctggggcccgcgggttgttagccatagaaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0433 Predicted ATPase ... can be seen here     ..................................................................................................................