                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=17 nt.     Delta G= -5.90 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-16.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTCCCCGAACGAGGCTTCGCCGGGAGGGTCTGGCGGGTTCTTGAGGGCGGGCTTCAC
ggtcttgtactcgaatctgtctgcgtggaggtatagaagcctcaaccctcagattcctccagaaggaagctctttaacacccgcataatatatgcccttc
gaaacgggctggggtcggcctccctaaaagcctcagcctttctaggaatagtaacggggctccgggagactccggatgccgagccccctcagggttttta
agcttccaatgtaggggtttattgattaggggattgaaaaatATG

    APE0119 --- APE0121 Gene: APE0119     GI: 14600463     BI number: APE0119     GOG: COG0468     Description: radA protein Gene: APE0121     GI: 14600464     BI number: APE0121     GOG: -------     Description: hypothetical protei ga a  c                 ta gt                 t  a gc                 t  g gc                 t  c cg                 t  t cg                  gt ta                  gc |  t                 gc |  g                |  a |  c        t       |  a |  c      c  c       at |  g      c  a       cg |  a       cg       |  t cg        cg        ta gc        cg        cg gc        gt        cg gc        at        cg gc        gt        cg                         tttattgattaggggattgaaaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0468 RecA/RadA recombinase ... can be seen here     ..................................................................................................................