                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:52 nt.     Distance to run of Ts=1 nt.   Size=31 nt.     Delta G= -9.20 kcal/mol
Antiterminator: Size=35 nt.     Delta G=-14.40 kcal/mol
Anti-antiterminator:   Size=23 nt.     Delta G= -7.92 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAGGCTGTAGTCAAGCTTGCTTATCTGCCCCTGTATCCTGTAGACAGCCTGTATTAT
CTGGTTTCTTATGGGCGGCGGAGGGCTTATGAAGTTCCTCAGCTTCTGGCCGACGGTC
TCGGTTGTAGACTCCGGCGGATTCCACTTTTTAGCCCAGCTTTCCAAGCCCATGGGAG
GCACcgtagggggtttagtagagtgtcccccatagaaggggagggcctgtacttctggggcatgacccgttttatattcctgcgaagttatatctcg
tcgagcgctggagtgtagggtggatcgctATG

    APE0145 Gene: APE0145     GI: 14600482     BI number: APE0145     GOG: NOG07230     Description: hypothetical protei             g           a  a           t  a           a  g        t            cg       c  t            cg       a  c            cg       t  t   a       |  a      g  g t  g       cg        tg g  a       cg        cg a  g       tg        cg t  t       gc        gc t  g      t  |      g  a t  t       gc       g  t gc        at       a  g gc       g  g      g  a gc        at        gc gc        ta        gc gc        gc        gc                         gttttatattcctgcgaagttatatctcgtcgagcgctggagtgtagggtggatcgctATG     ..................................................................................................................