                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:139 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=28 nt.     Delta G= -8.89 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCCTGGAAGGAAGGTGGGCCATATAGCTGCCAGGAGGACTGGGAGGAGGAAGAGGTAG
aggccactaaacagaggccacacaaccacgccccacctcctcacagccggggggaaatccaaaaccgccaccccctcagaacttgggggcccgacatttt
gtccgatagaagcctggagggtaagggagctgtaatcagggagaagtacgaggcgacatgcagcggttatgacgagctgtatagggctgaacagtatgag
aagtttttcgttgccctaaagagggttaggccccagggtaggGTG

    APE0216 Gene: APE0216     GI: 14600537     BI number: APE0216     GOG: COG0500     Description: hypothetical protei                       a            aa       g  a   a       a  a      a  c c  c      c  c      c  t t  a      c  c      t  t c  g      t  g       cg c  c      a  c       cg t  c      a  c       cg cg       a  a       cg cg        gc        cg a  |       gc       a  c cg        gc       c  c cg        gc       c  | cg        gc        gc cg        gt        cg                         acattttgtccgatagaagcctggagggtaagggagctgtaatcagggagaagtacgaggcgacatgcagcggttatgacgagctgtatagggctgaacagtatgagaagtttttcgttgccctaaagagggttaggccccagggtaggGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [QR] COG0500 SAM-dependent methyltransferases ... can be seen here     ..................................................................................................................