                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=36 nt.     Delta G=-11.70 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-21.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGGATGCAGCGGGCTGTGCCAGAGGGCCTCGGAGCGGGGGTATATGGGCGAGCTCAG
GTACAGCCACGGCAGCTGCAGCTGCGGCCTCCCAACACCTCCAGGCAGGTCTGAGGCG
GCGGAGGCTTATAGGAGGCTGGCGGCCTCTATATCGCTTTCGATGCTCGAGGTCCTAG
ggatgctcggacgggcaggagaccccttttatcaccgctagactaataatactgggattaagctattggaggtgtgcccgggggttgtcagggaggataa
agttctgccctagatgcggttccataATG

    APE0442 --- APES017 Gene: APE0442     GI: 14600713     BI number: APE0442     GOG: COG1594     Description: DNA-directed RNA polymerase subunit M Gene: APES017     GI: 14600712     BI number: APES017     GOG: -------     Description: hypothetical protei   A T  G A  G TA TG CG GC GT A  G G  | G  | CG        TT        ga GC       C  T      g  c G  G       GC        cg CG        CG        tg GC        TA        cg GC        AT        gc AT        TG        ta GC       |  C      a  | |  T      A  T      g  | T  A      T  C      g  | C  T       CG       G  | TA        TA       A  | GT        CG        Tg GC        CG        Cg A  |       GT       |  a CG        GC        Cg GC       C  |       Ta GT        GC        Gc AT        GT        Gc                         ccttttatcaccgctagactaataatactgggattaagctattggaggtgtgcccgggggttgtcagggaggataaagttctgccctagatgcggttccataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG1594 DNA-directed RNA polymerase, subunit M/Transcription elongation factor TFIIS ... can be seen here     ..................................................................................................................