Gene putatively regulated by attenuation in A_pernix
Characteristics of the secondary structures
Terminator: Distance to gene:44 nt. Distance to run of Ts=0 nt. Size=38 nt. Delta G=-12.80 kcal/mol
Antiterminator: Size=46 nt. Delta G= -9.00 kcal/mol
Anti-antiterminator: Size=55 nt. Delta G= -4.68 kcal/mol
Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
CTATCCCTAACACCTAGGCTCTGCAGCTCGCCCAACCTCGCCTCTTCAACCGCGAAGC
CCGCCACAACGAGATCCCCGACTAAGCTTCCCCTGCCAGCCTCATCCACGCCGACGAC
TATGCCCAAGGCCATttatcctctccgcctgccaaactatactattaatattaacccggaattataggattatctttaggctttccaca
ctcatgtatgaagccgggctgtggtgtagggcggcttgggcgcgtttttctttaaaagaacgcgggacgacgttgcaggcgaggtagccaggataGTG
APE0493
Gene: APE0493 GI: 14600756 BI number: APE0493 GOG: ------- Description: hypothetical protei
ac
a c
t c
t g
a g
t a tc
a a c a
a t at
t t cg
ta at gt
at c a t a
ta c t g g
cg tg g g
a g ta tg
t a ta gc
a t cg tg
t t gc cg
c a gc gc
a t a g gt
a c t g gt
a t t g cg
c t t c cg
c | c t g g
gt tg a c
ta at a g
cg tg gc
cg tg tg
gc at at
ttttctttaaaagaacgcgggacgacgttgcaggcgaggtagccaggataGTG
..................................................................................................................