Gene putatively regulated by attenuation in A_pernix
Characteristics of the secondary structures
Terminator: Distance from promoter:123 nt. Distance to gene:25 nt. Distance to run of Ts=0 nt. Size=27 nt. Delta G= -7.10 kcal/mol
Antiterminator: Distance from promoter:89 nt. Size=40 nt. Delta G=-20.50 kcal/mol
Anti-antiterminator: Distance from promoter:51 nt. Size=59 nt. Delta G=-13.40 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttggcg-tatact. It has a score value of 70.95 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttggcggttcaacgtagatatgttatactgtctatcctttgcgacctaatgcgactggggctatcttgtagttgcttgtgttaacatgactgcaaaaagg
aggctgctttacctgctagtcctgtcggcggagtggtaagctctccgctgcagaggactaagccacgttggctgtttttatttttgagttgagtgctggg
agagttgaaGTG
APE0536
Gene: APE0536 GI: 14600787 BI number: APE0536 GOG: ------- Description: hypothetical protei
tt
t a
c c
g c
t t
cg
gc
gt
| a
| g
at aa
gc t g
gc gc
at gt
a g t |
a t gc
a c at g
a g gc c t
cg gc a t
gc cg cg
tg gc cg
cg gt gc
a a cg at
g | | c a |
tg t a t |
at g g cg
cg ta at
a g cg gt
at cg gt
ta ta at
ta gc gt
atttttgagttgagtgctgggagagttgaaGTG
..................................................................................................................