                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:47 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.40 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -5.80 kcal/mol
Anti-antiterminator:   Size=57 nt.     Delta G= -5.66 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGCAGCATCCACCCATTTCAGTATTCATATCTCCCGCGTCTAGCAGGAGGGGTTTT
GAGGCTATATTAGCGCCGTAATACGCCATCATtgtctacatcctcgttattaaaattattttcaaactaagtattt
atacatagaacttaacgatggattacccagagagaaaggccgtgatagataatgtatttgaataagtcgtccattagaatagcgcttccaggtactcaca
atttgtgagtctccgtttttaaagcacccctcaatatcctagggtggacatgcgaggtggtatgagATG

    APE0596 Gene: APE0596     GI: 14600825     BI number: APE0596     GOG: -------     Description: hypothetical protei ag t  a a  t g  a ta gt cg c  t        a g  a      t  g gt       t  a at       a  a at       c  t a  g      c  a g  a       tg a  a       gc g  t       cg a  a      t  | g  a       gc         t a  |       at       a  t c  |       at       a  t c  |      t  c       cg cg       a  |       at at       a  |       cg t  c       gc        ta tg        ta        cg at        tg        at gc        tg       |  c gc        at       t  t ta        ta        gc at        gc        gc                         gtttttaaagcacccctcaatatcctagggtggacatgcgaggtggtatgagATG     ..................................................................................................................