                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-13.30 kcal/mol
Antiterminator: Size=26 nt.     Delta G=-12.20 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-12.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCTCCCACACCGCCTACCCCGAGGCCCGGCCTGACCTGCACttaccttgcctgggaggaggtgttgta
TGGTGGACCGGCCGGGATTTGAACCCGGGGCCTCCCGGATGCCAACCGGGCGCTCTTC
CAGGCTGAGCTACCGGCCCacacccgcgcctccgctggaggcgcggcgccccaggatacctatcatatctttttgaagaggtttta
aggattaggccttccCTAGGCTGGAGGGTGGCCGTAAAACCCCTGGGGGCTCTCTAGTTTTTGA
GGTGGACGGTCTTGCCGGGGGCGGTG

    APE0680 Gene: APE0680     GI: 14600887     BI number: APE0680     GOG: COG0824     Description: ORF tg t  a ta tg ta cg tg at |  t |  t |  t |  a t  a a  g cg                   A ta                 A  C |  t                A  C at                 A  C ta                 T  C cg         C        GT cg       G  T       CG |  c      G  G       CG a  c      A  G      G  G t  t       TA       G  G at        CG        TG gc        cG        GC gc        cG        GT a  C      t  T       GC c  T      t  |       AT c  A       cG        GC cG        cG        GT cG        gC        TA gC        gC        CG                         TTTTTGAGGTGGACGGTCTTGCCGGGGGCGGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0824 Predicted thioesterase ... can be seen here     ..................................................................................................................