                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:107 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.40 kcal/mol
Antiterminator:    Distance from promoter:41 nt. Size=36 nt.     Delta G= -9.50 kcal/mol
Anti-antiterminator:    Distance from promoter:12 nt.    Size=45 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttagca-taatat. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttagcatggtcgcggtagaaggataatattaattggagtagaacagcctcgccaagaataggctacactaggcgagtaggcgagttaagactcaaaccct
ggcgtcattgcggcaagtgatgcagccatcttttacaccgtcaggtatgatctttacctcaaaattagtgtaacaggttaatacatatattgggttataa
cgaccgctagtaaattcaccgcctctggcgaggatttcaATG

    APE0688 Gene: APE0688     GI: 14600895     BI number: APE0688     GOG: COG0346     Description: hypothetical protei ta c  c g  a gc at ta a  | a  |       aa g  |      t  g a  |       ta a  |       gc cg        at cg        gc         c gc       |  a      g  a cg       |  a      g  a ta       |  a       cg |  g      c  c       gt |  t       gc        tg |  a       gc        ta cg        at        at cg        tg        cg gc       g  g      t  c |  g      a  |      g  a a  a       gc        cg cg        cg        gc at        gt        gc at        gc        ta                         tcttttacaccgtcaggtatgatctttacctcaaaattagtgtaacaggttaatacatatattgggttataacgaccgctagtaaattcaccgcctctggcgaggatttcaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0346 Lactoylglutathione lyase and related lyases ... can be seen here     ..................................................................................................................