                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:96 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -5.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCGCTCTATAAACCTTTATAGTCTTACTGCTCCACCCTGTGCTTTCTAGTATTGTCAA
GAAGAGCCTAGCTGCATCCTCTAAACTATACTCCCTAATATCCCTAGGAGGCGGCGGC
AGAGACTCTATAGAACCGGCTCTAGCCATagctaaccccggaatacgtatttggcgtgtaggacacgagacccgtgacg
gccggtattttcagggttataccgcggccaccctctagccttctttgaggcccccttgaggatctagactcggcgaaaattcagtttgataagtattccc
cgttaATG

    APE0807 Gene: APE0807     GI: 14600983     BI number: APE0807     GOG: COG1012     Description: delta-1-pyrroline-5-carboxylate dehydrogenas             a           g  c           a  c            gc            cg            at   t        cg t  t      a  | a  g      g  | tg       g  | gc       a  | cg        ta at        gc tg        tg at       g  | a  a       cg g  |       gc g  |       gc cg        tg cg        tg             tattttcagggttataccgcggccaccctctagccttctttgaggcccccttgaggatctagactcggcgaaaattcagtttgataagtattccccgttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1012 NAD-dependent aldehyde dehydrogenases ... can be seen here     ..................................................................................................................