Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=3 nt.   Size=10 nt.     Delta G= -6.30 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-20.70 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-12.23 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAGCAGGATGTCCGCCGCGCTCAGGCTCAGGATGATGGAGCTGAACAAGCTCTACGTC
ACTGGCCTCGACTACTTCCACAAACGCCTCGACTCGGCCGTCTCAAGGGCCTACTCCC
TCGTGGAGGCCTGAggccgaaaggcggctattttggcctctcacaccagatcctttaagcgctttgtgcagacgaccagccctgtttcta
tacttaaacgtttctcagcgtttcagcaggtaaacatttatatagaagggaagtaacgataggtacctggaacttatggtgtcttgggtaacggGTG

    APE0907


Gene: APE0907     GI: 14601065     BI number: APE0907     GOG: COG0459     Description: thermosome subuni


  A
C  C
C  A
T  A
T  A
C  C
A  G       CG
T  C      T  T
C  C       CG
 AT        CG
 GC       C  |
 CG       T  |
 TA       C  |
|  C      A  |
|  T       TA
|  C       CG
 CG        CG
 CG        GC
 GC        GC
 GC        GT
T  |      A  |
 CG       A  |
 AT       C  |
C  C      T  |
T  T       CG
G  C       TA
C  A      G  |
A  |       Cg
 TA        Cg        aa
 CG        Gc       g  a
 TG        Gc        cg
 CG        Cg        cg
 GC        Ta        gc
                        ggctattttggcctctcacaccagatcctttaagcgctttgtgcagacgaccagccctgtttctatacttaaacgtttctcagcgtttcagcaggtaaacatttatatagaagggaagtaacgataggtacctggaacttatggtgtcttgggtaacggGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[O] COG0459 Chaperonin GroEL (HSP60 family) ... can be seen here

    ..................................................................................................................