                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:34 nt.     Distance to run of Ts=3 nt.   Size=26 nt.     Delta G=-11.90 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -3.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

acccttcgcgtatacgcttacgtagagtatctcaagtatgtatcataatgttgagtttcgtgagatcataagcttctacctgcattcggcatttaggtca
ttggatcggagctagaacttaaggtgtttgcttaatattggaaaaggtgcatgttctatatatttgccaggttactaagggttacagtgttactagcctt
aattagatcttctaggaataaacctaataacgtttgtgctactgctagcatggacgctatttattgttgatccctatatatctttttggtggcatgatgc
ATG

    APE1181 --- APE1180 --- APE1179 --- APE1178 Gene: APE1181     GI: 14601231     BI number: APE1181     GOG: COG1209     Description: glucose-1-phosphate thymidylyltransferase Gene: APE1180     GI: 14601230     BI number: APE1180     GOG: COG1088     Description: dTDP-glucose 4,6-dehydratase Gene: APE1179     GI: 14601229     BI number: APE1179     GOG: COG1091     Description: dTDP-4-dehydrorhamnose reductase Gene: APE1178     GI: 14601228     BI number: APE1178     GOG: COG1898     Description: dTDP-4-dehydrorhamnose 3,5-epimeras at a  a t  a       tg c  c      c  c cg        at at        ta at        cg at        gc tg        ta at       g  t a  g      t  g g  |       tg gc        ta at        gc ta        cg             ctatttattgttgatccctatatatctttttggtggcatgatgcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1209 dTDP-glucose pyrophosphorylase ... can be seen here [M] COG1088 dTDP-D-glucose 4,6-dehydratase ... can be seen here [M] COG1091 dTDP-4-dehydrorhamnose reductase ... can be seen here [M] COG1898 dTDP-4-dehydrorhamnose 3,5-epimerase and related enzymes ... can be seen here     ..................................................................................................................