                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=1 nt.   Size=35 nt.     Delta G=-10.22 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-22.70 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G=-13.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atttatggtcaaactttcaaataaaacccgaaatataggagatatttaactaaagaatagagacaaaaactactggaaagagtataaaagctagaaacat
gtattagcctctatttctcgggtagcttaagcttggctgggagtgtttttgttgttcttgctggcggtaggggggagaggctttggcctgttagtgagac
tagggctaagcctctcgtccctatcttgggggagcctcttgtttgtaggcatttgaggctgggtttggctacggggttgtttgacgaggctgttgttctc
GTG

    APE1202 Gene: APE1202     GI: 14601247     BI number: APE1202     GOG: COG1208     Description: sugar phosphate transferas             a   g       g  g a  a      t  a g  g       gc g  g       at         c gc        ta       c  t gt       t  |      c  a gt       g  |      t  t g  t       tg       g  c a  g       cg       c  t tg        cg       t  t gc        gc        cg gc        gt        tg |  t      t  |       cg cg        ta        cg gt        ta       g  g gt        cg       a  | ta        gc       a  | cg        gc        ta g  t       at        cg t  g       gc        gc ta        at        gc cg        gc        gt                         cttgtttgtaggcatttgaggctgggtttggctacggggttgtttgacgaggctgttgttctcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [MJ] COG1208 Nucleoside-diphosphate-sugar pyrophosphorylase involved in lipopolysaccharide biosynthesis/translation initiation factor 2B, gamma/epsilon subunits (eIF-2Bgamma/eIF-2Bepsilon) ... can be seen here     ..................................................................................................................