Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:57 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=74 nt.     Delta G= -6.91 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGGTAACAAAGTTCAGAAGCCTGGAGGAGGCTCCAGAGGCCTTCGAAGCATCGCTGG
ACAGGGAGAGCATGAAGATTGTAGTCACCATATAGacgtctgtatccggggggattcggttaccactgcctcat
cgctactcgtcttcgaccggcagattatatgtacaaaactgatgttccacgctgaaaaccctccaccagtataaaacaatacacgcccggcctcttggcg
gccgggtttttgtggagggtggttgacctttgtctcgccggatagcggctgccttgttcctcatcctaGTG

    APE1244


Gene: APE1244     GI: 14601285     BI number: APE1244     GOG: COG1073     Description: hypothetical protei


            g
          t  a
          c  a
          g  a
          c  a
          a  c
          c  c
          c  c
          t  t
          t  c
           gc
           ta
          a  c
           gc
           ta
           cg
           at
          a  a
          a  t
          a  a
          c  a
  c       a  a
t  g       ta
c  t       gc
a  c       ta
t  t      a  |
c  t       ta         t
 gc        at       t  g
 cg        ta       c  g
 ta       t  c      t  c
a  c      a  a       cg
c  c      g  c       cg
t  |      a  g       gc
 cg       c  c       gc
 cg        gc        cg
 gc        gc        cg
 ta        cg        cg
 cg        cg        gt
                        ttttgtggagggtggttgacctttgtctcgccggatagcggctgccttgttcctcatcctaGTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG1073 Hydrolases of the alpha/beta superfamily ... can be seen here

    ..................................................................................................................