Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:110 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=44 nt.     Delta G= -9.30 kcal/mol
Anti-antiterminator:   Size=66 nt.     Delta G=-13.67 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATATCCCCACGGCCCTGCTCCTAACCAGCGCCCAGCCCTCAGGCTGCTCGGGGGGCG
GGAGGTCCTCAACCCTTACATCACCCGGCCCATATAGGACGGCAGCCCTCAACGCGTC
TTCCCCTGCCATccaaatagttgcctgaaagccctctattaacgtggcctcccagccggcagcccggtggtttttgagtgacggttaactc
tcaggcagtcagctgtgtgattttgacgtggatgctattccgtagtaatattataaacggtctctaggagcggagtatactatttataatattGTG

    APE1248


Gene: APE1248     GI: 14601287     BI number: APE1248     GOG: -------     Description: hypothetical protei


 GC
C  G
A  T
A  C
C  T
T  T
C  C
C  C
C  C
 GC
 AT
 CG         t
 GC       t  a
 GC       a  a
C  A      t  c
 AT       c  g
 Gc       t  t
 Gc        cg
|  a       cg
A  a      c  c
 Ta        gc
 At        at
 Ta       a  c
A  g      a  c
C  t       gc
C  t       ta        ag
 Cg       |  g      c  c
 Gc       |  c       gc
 Gc       |  c       gc
C  |       cg        cg
C  |       cg        cg
C  |       gc       g  |
 At        ta        at
 Cg        tg        cg
 Ta        gc        cg
                        tttttgagtgacggttaactctcaggcagtcagctgtgtgattttgacgtggatgctattccgtagtaatattataaacggtctctaggagcggagtatactatttataatattGTG
    ..................................................................................................................