                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:191 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GAGCACCCCTAGGAGGAATTCCCGCCTGGTCAGTGGGGGGGTCAACGCATGCTCACCC
TGTTCACATTTGAAAATGCCGGGACAAACGGGGGTCTCCGGGAGTGTTTTCCTTCACC
AGGGCCTGTGGGGTTGGAGCCCCCGGGATACCCGTGTAATACGCGATGTAGCCGGTAT
TACTCTGGGCTCCCTACTCTGGGCTCTAAACCTACGTCATTGAggtaatactcaaattagccttgcgg
cccagcagtagttctatgggtttaaaggcttagcccgggattgtgtggtgctgttttaATG

    APE1281 Gene: APE1281     GI: 14601310     BI number: APE1281     GOG: COG1078     Description: hypothetical protei            TC           T  A            GC            TA           C  T           C  T CG       C  | A  C       AT A  A       CG C  T       TA TG       C  A       CG GC       G  A      A  G GT        TA       A  G GC        AT       A  G |  A       CG        CG GC        GC        AT GC       C  C       GC GC       A  G      |  T G  T      A  G       GC T  G       CG        GC GT        TA        CG AT        GC        CG                         GAGTGTTTTCCTTCACCAGGGCCTGTGGGGTTGGAGCCCCCGGGATACCCGTGTAATACGCGATGTAGCCGGTATTACTCTGGGCTCCCTACTCTGGGCTCTAAACCTACGTCATTGAggtaatactcaaattagccttgcggcccagcagtagttctatgggtttaaaggcttagcccgggattgtgtggtgctgttttaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1078 HD superfamily phosphohydrolases ... can be seen here     ..................................................................................................................