                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-14.17 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-18.10 kcal/mol
Anti-antiterminator:   Size=19 nt.     Delta G= -6.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCCTCCTACTGCTCGGCGCCGGGCTAACCCTGGCCACGGCCGGGTTCATAGTGTTCC
AGGCGGGCCTGGCTATCATGGCCTATGGGGCGAGGAGCCGCGGCGGCCCAGACACCTC
TATGACTCTACTCCTCGTAGGCGCCTCACTGGCGCTCATTGGGGCGGCGGTGGGTGTT
AGTGCAGCAGTTCTCGCAGGGATGGCTATAGAGGCCGCCTCCTTCTACAGGCTCCGCA
GCCCGCCGAGCGGCGGTTCTAGGCTGGAGGGCGAAACTTTATGAttctgggcccccggcattttatg
gATG

    APE1340 --- APE1343 Gene: APE1340     GI: 14601344     BI number: APE1340     GOG: COG1110     Description: reverse gyrase Gene: APE1343     GI: 14601345     BI number: APE1343     GOG: COG0388     Description: hypothetical protei            AG           G  C            CG            CG            GC        AT            CG       T  G           |  G      T  A           |  T      T  t           |  T      C  t           |  C      A  c           |  T      A  t           |  A      A  g            CG       G  g   C        CG        Cg G  C       GC        Gc A  C       AT        Gc CG        CG        Gc GC       G  G      A  | C  C      C  A       Gc CG        CG        Gc TA        TG        Tg CG        CG        Cg GC        GC        Gc                         attttatggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1110 Reverse gyrase ... can be seen here [R] COG0388 Predicted amidohydrolase ... can be seen here     ..................................................................................................................