Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G=-12.00 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-14.76 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -9.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcttcaccgtggagatgtaaggagtcccgaagttttaggggaatctcgggctgctatacgccagtaataccgggtgttttgcgattgacaagatagcatc
taatccttcctctggagctgtgggagttaacttcaagtggaaacaagccgcccctcccaacccctaacaccctatatacaagctgccccctcctggggcg
gttgtttagcggtgttaatgcagatacttacaggtgctaaacagcctgtgctagagcaccttcaataccggggagtagcctgttgagcaggtctaccaag
ATG

    APE1495 --- APE1494


Gene: APE1495     GI: 14601441     BI number: APE1495     GOG: COG0667     Description: hypothetical protein
Gene: APE1494     GI: 14601440     BI number: APE1494     GOG: -------     Description: hypothetical protei


           aa
          g  a
           gc
           ta
          g  a
          a  g
          a  c
          c  c
          t  g
          t  c
          c  c
          a  c
          a  |
          t  |
          t  |
           gc
           at
           gc
           gc
           gc
  c        ta
c  t      |  a
t  c      |  c
t  t      |  c
 cg       |  c
 cg       |  c
 ta       |  t
|  g      |  a
|  c      |  a
|  t      |  c
a  g      |  a
 at       |  c
 tg       |  c
 cg       |  c
t  g      |  t
a  a      |  a
 cg       |  t
 gt       |  a
 at       |  t
 ta       |  a        c
a  a      |  c      t  c
 gc       g  a      c  t
 at        ta        cg
a  |       cg        cg
c  |       gc        cg
 at        at        cg
 gc       |  g       gc
 ta        gc        tg
 ta        gc        cg
                        ttgtttagcggtgttaatgcagatacttacaggtgctaaacagcctgtgctagagcaccttcaataccggggagtagcctgttgagcaggtctaccaagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[C] COG0667 Predicted oxidoreductases (related to aryl-alcohol dehydrogenases) ... can be seen here

    ..................................................................................................................