                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:103 nt.     Distance to run of Ts=3 nt.   Size=32 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-12.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCCAGGGATGTGAGGCTCCTCATAGTAGCAGTTATCACCGCGGCCGGAAGGCCTCTGG
AGGCGATGGCGGCGGTGGCGCTTCTCTCACACGCCTACGTTGCCGTAAAGTCGATCTA
CCTGTTCTCCCTCCTCAAATCCAAGGGTGTCTAGacggagggctccgttaacgcttaaatccggggggtccaact
tttatcatggggttttcaaagtctcggagcaccactatctagcctccccaggggctcttgattagcgtaaaataaccccctttaactctacatccggagg
tgacgtggcGTG

    APE1517 Gene: APE1517     GI: 14601456     BI number: APE1517     GOG: COG1260     Description: myo-inositol-1-phosphate synthas AA C  G       aa CG       t  a TG       t  t AT       c  c |  G       gc |  T       cg |  C      a  g A  T      a  | A  A      t  | CG       t  | Ta       g  | |  c       cg Cg        cg Cg        tg Ta        cg Cg        gt Cg        gc Cg        gc             aacttttatcatggggttttcaaagtctcggagcaccactatctagcctccccaggggctcttgattagcgtaaaataaccccctttaactctacatccggaggtgacgtggcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [I] COG1260 Myo-inositol-1-phosphate synthase ... can be seen here     ..................................................................................................................