                                                                        Gene putatively regulated by attenuation in A_pernix

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=38 nt.     Delta G=-13.50 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGATATTCCCCTGGGAACCCTAGCTTCTCCAGATAGTCCCAGTCCTTGAGGTCTAGG
GGCGTGTAGAGCCGTCTAACCGGGATGTCGCTGAGCGTGGTGAAGCTTTCCATCCTCT
CAGGCATTCTCTCAAGCCATTGTGGGAGGGTCTCGCTCTCCCACTTCTTTAAAGAGGC
TTCAAGCCGCTTCACGTACTCGGGGTCGAAGAAGGGCACacctatctaccccgcgttcgaacaacagccta
tatatagctctccgctccaaacaggttattattgtcgaactagaacgattatagcATG

    APE1688 Gene: APE1688     GI: 14601557     BI number: APE1688     GOG: COG0614     Description: hypothetical protei   G A  C A  T       TC G  T      C  T T  T      T  C GC       T  A GC       A  A TA        CG GT        GC C  C       GC GC       |  A AT       |  T        T GC       |  T      C  C T  T      |  G      T  G C  C       AT        GC G  A       CG        GT CG        TG        GC TG        CG        AT GC        TA        GC TA        CG        GC AT        CG        GC GT        TG        TA GC        AT        GC                         TTCTTTAAAGAGGCTTCAAGCCGCTTCACGTACTCGGGGTCGAAGAAGGGCACacctatctaccccgcgttcgaacaacagcctatatatagctctccgctccaaacaggttattattgtcgaactagaacgattatagcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here     ..................................................................................................................